Skip to content
By using Twitter’s services you agree to our Cookies Use. We and our partners operate globally and use cookies, including for analytics, personalisation, and ads.
  • Home Home Home, current page.
  • About

Saved searches

  • Remove
  • In this conversation
    Verified accountProtected Tweets @
Suggested users
  • Verified accountProtected Tweets @
  • Verified accountProtected Tweets @
  • Language: English
    • Bahasa Indonesia
    • Bahasa Melayu
    • Català
    • Čeština
    • Dansk
    • Deutsch
    • English UK
    • Español
    • Filipino
    • Français
    • Hrvatski
    • Italiano
    • Magyar
    • Nederlands
    • Norsk
    • Polski
    • Português
    • Română
    • Slovenčina
    • Suomi
    • Svenska
    • Tiếng Việt
    • Türkçe
    • Ελληνικά
    • Български език
    • Русский
    • Српски
    • Українська мова
    • עִבְרִית
    • العربية
    • فارسی
    • मराठी
    • हिन्दी
    • বাংলা
    • ગુજરાતી
    • தமிழ்
    • ಕನ್ನಡ
    • ภาษาไทย
    • 한국어
    • 日本語
    • 简体中文
    • 繁體中文
  • Have an account? Log in
    Have an account?
    · Forgot password?

    New to Twitter?
    Sign up
danluu's profile
Dan Luu
Dan Luu
Dan Luu
@danluu

Tweets

Dan Luu

@danluu

https://patreon.com/danluu 

danluu.com
Joined December 2008

Tweets

  • © 2019 Twitter
  • About
  • Help Center
  • Terms
  • Privacy policy
  • Imprint
  • Cookies
  • Ads info
Dismiss
Previous
Next

Go to a person's profile

Saved searches

  • Remove
  • In this conversation
    Verified accountProtected Tweets @
Suggested users
  • Verified accountProtected Tweets @
  • Verified accountProtected Tweets @

Promote this Tweet

Block

  • Tweet with a location

    You can add location information to your Tweets, such as your city or precise location, from the web and via third-party applications. You always have the option to delete your Tweet location history. Learn more

    Your lists

    Create a new list


    Under 100 characters, optional

    Privacy

    Copy link to Tweet

    Embed this Tweet

    Embed this Video

    Add this Tweet to your website by copying the code below. Learn more

    Add this video to your website by copying the code below. Learn more

    Hmm, there was a problem reaching the server.

    By embedding Twitter content in your website or app, you are agreeing to the Twitter Developer Agreement and Developer Policy.

    Preview

    Why you're seeing this ad

    Log in to Twitter

    · Forgot password?
    Don't have an account? Sign up »

    Sign up for Twitter

    Not on Twitter? Sign up, tune into the things you care about, and get updates as they happen.

    Sign up
    Have an account? Log in »

    Two-way (sending and receiving) short codes:

    Country Code For customers of
    United States 40404 (any)
    Canada 21212 (any)
    United Kingdom 86444 Vodafone, Orange, 3, O2
    Brazil 40404 Nextel, TIM
    Haiti 40404 Digicel, Voila
    Ireland 51210 Vodafone, O2
    India 53000 Bharti Airtel, Videocon, Reliance
    Indonesia 89887 AXIS, 3, Telkomsel, Indosat, XL Axiata
    Italy 4880804 Wind
    3424486444 Vodafone
    » See SMS short codes for other countries

    Confirmation

     

    Welcome home!

    This timeline is where you’ll spend most of your time, getting instant updates about what matters to you.

    Tweets not working for you?

    Hover over the profile pic and click the Following button to unfollow any account.

    Say a lot with a little

    When you see a Tweet you love, tap the heart — it lets the person who wrote it know you shared the love.

    Spread the word

    The fastest way to share someone else’s Tweet with your followers is with a Retweet. Tap the icon to send it instantly.

    Join the conversation

    Add your thoughts about any Tweet with a Reply. Find a topic you’re passionate about, and jump right in.

    Learn the latest

    Get instant insight into what people are talking about now.

    Get more of what you love

    Follow more accounts to get instant updates about topics you care about.

    Find what's happening

    See the latest conversations about any topic instantly.

    Never miss a Moment

    Catch up instantly on the best stories happening as they unfold.

    Dan Luu‏ @danluu 15 Oct 2016
    • Report Tweet

    #5 most common google search term for my blog: GTGACCTTGGGCAAGTTACTTAACCTCTCTGTGCCTCAGTTTCCTCATCTGTAAAATGGGGATAATA 😂 #4: "i could" 😁pic.twitter.com/BzIq1ItPos

    9:17 AM - 15 Oct 2016
    • 4 Retweets
    • 31 Likes
    • Cornelle JvR Sandy Vanderbleek 🧢 𝕳𝖊𝖑𝖑 🏴‍𝕴𝖘𝖑𝖆𝖓𝖉 Nick White Arnaud Schenk John Regehr Alexander Tarasikov _ Rafael Ferreira
    3 replies 4 retweets 31 likes
      1. Michael Wiik‏ @mwiik 15 Oct 2016
        • Report Tweet
        Replying to @danluu @vgr

        Michael Wiik Retweeted Michael Wiik

        Not my fault I hopehttps://twitter.com/mwiik/status/197066714813444096 …

        Michael Wiik added,

        Michael Wiik @mwiik
        Replying to @GlennF
        @GlennF I once considered tweeting DNA knock-knock jokes, but realized google would pick up my nonsense sequences and corrupt valid data.
        0 replies 0 retweets 0 likes
        Thanks. Twitter will use this to make your timeline better. Undo
        Undo
      1. Raunak S‏ @RonInDune 15 Oct 2016
        • Report Tweet
        Replying to @danluu

        Hmm, googling that sequence now leads me to this: http://www.biomedcentral.com/content/supplementary/1471-2164-13-400-S5.pdf …

        0 replies 0 retweets 0 likes
        Thanks. Twitter will use this to make your timeline better. Undo
        Undo
      1. James Hubbard‏ @bardhub 15 Oct 2016
        • Report Tweet
        Replying to @danluu

        Guilty. I did it just to see what would turn up.

        0 replies 0 retweets 0 likes
        Thanks. Twitter will use this to make your timeline better. Undo
        Undo

    Loading seems to be taking a while.

    Twitter may be over capacity or experiencing a momentary hiccup. Try again or visit Twitter Status for more information.

      Promoted Tweet

      false

      • © 2019 Twitter
      • About
      • Help Center
      • Terms
      • Privacy policy
      • Imprint
      • Cookies
      • Ads info