Davide Castaldi

@castaldi_davide

PhD Student in Computational Biology. Geek. Biker.

Vrijeme pridruživanja: studeni 2018.

Tweetovi

Blokirali ste korisnika/cu @castaldi_davide

Jeste li sigurni da želite vidjeti te tweetove? Time nećete deblokirati korisnika/cu @castaldi_davide

  1. proslijedio/la je Tweet
    31. sij

    <2 weeks left to apply to our 2 postdoc positions Human Organoid Models Integrative Center we are looking for enthusiastic innovators to spearhead organoid technology across developmental biology and bioengineering thread please RT

    Prikaži ovu nit
    Poništi
  2. proslijedio/la je Tweet
    Poništi
  3. proslijedio/la je Tweet
    19. pro 2019.

    Very grateful with , for the chance to enjoy groundbreaking science at , , here seen sharing his vision on .

    Poništi
  4. proslijedio/la je Tweet
    18. pro 2019.

    Ultra-high throughput scRNA-seq from Christoph Bock's lab! Combines combinatorial barcoding with droplet microfluidics to sequence >150,000 cells on a single lane:

    Poništi
  5. proslijedio/la je Tweet
    15. pro 2019.

    New lab paper up. Vireo allows for multiplexed single cell analysis using natural genetic variants for demultiplexing. The model can use existing genotype references or cluster samples de novo. With ⁦⁩ and ⁦⁦⁩.

    Poništi
  6. proslijedio/la je Tweet
    12. pro 2019.
    Prikaži ovu nit
    Poništi
  7. proslijedio/la je Tweet

    A new study suggests modern humans domesticated themselves after they split from their extinct relatives, Neanderthals and Denisovans, approximately 600,000 years ago.

    Poništi
  8. proslijedio/la je Tweet
    16. stu 2019.

    Thymic epithelial progenitors from human iPSCs. Thanks to for letting me work on this intriguing subject.

    Poništi
  9. proslijedio/la je Tweet
    21. lis 2019.

    delighted to share our latest work Human Cortical Organoids Expose a Differential Function of GSK3 on Cortical Neurogenesis

    Prikaži ovu nit
    Poništi
  10. 2. lis 2019.

    Very proud and super excited to enroll in the Systems Medicine - Computational Biology PhD program at SEMM, as the first-generation of students in 's Lab!

    Poništi
  11. proslijedio/la je Tweet
    2. lis 2019.

    Diamo il benvenuto ai sette scienziati del team ! Portano in Italia 🇮🇹 la loro esperienza per sviluppare i nostri primi centri di ricerca: genomica, neuro-genomica, biologia computazionale & strutturale. Maggiori info sul nostro sito:

    Poništi
  12. proslijedio/la je Tweet
    24. ruj 2019.

    Single cell warm up for , together with at , special thanks to and all the lab. Exciting and thriving event by and other great participants

    Poništi
  13. proslijedio/la je Tweet
    15. srp 2019.

    scRNAseq folks: please try our new method. it assigns a genotype to each cell using variants from the reads while also estimating and accounting for ambient RNA from the "soup". it does better than anything else out there right now. congrats on great work.

    Poništi
  14. proslijedio/la je Tweet
    22. srp 2019.

    so thrilled to be part of such exciting developments; stay tuned fo our awesome spearheading analytical single-cell omic strategies for organoids and representing the at the unconference

    Poništi
  15. proslijedio/la je Tweet
    12. tra 2019.

    5.4.5 is released, with improved error messages and a minor bug fix:

    Poništi
  16. proslijedio/la je Tweet
    22. ožu 2019.
    Poništi
  17. proslijedio/la je Tweet
    18. sij 2019.

    Takeaways from amazing : 1. Spatial technologies are mature, and are tremendously exciting 2. Integrating scRNA-seq data with cell morphology, location, and functional readouts is key for interpretation 3. Single cell genomics is transforming developmental biology

    Poništi
  18. proslijedio/la je Tweet
    25. pro 2018.

    ATGGAGAGGAGGTACTGCCACAGGATCAGCACCATGGCCAGCGCCAACGACGCCCACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG from everyone at Ensembl!

    Poništi

Čini se da učitavanje traje već neko vrijeme.

Twitter je možda preopterećen ili ima kratkotrajnih poteškoća u radu. Pokušajte ponovno ili potražite dodatne informacije u odjeljku Status Twittera.

    Možda bi vam se svidjelo i ovo:

    ·