Tweetovi
- Tweetovi, trenutna stranica.
- Tweetovi i odgovori
Blokirali ste korisnika/cu @castaldi_davide
Jeste li sigurni da želite vidjeti te tweetove? Time nećete deblokirati korisnika/cu @castaldi_davide
-
Davide Castaldi proslijedio/la je Tweet
<2 weeks left to apply to our 2 postdoc positions
@LaStatale#HOMIC Human Organoid Models Integrative Center we are looking for enthusiastic innovators to spearhead organoid technology across developmental biology and bioengineering thread please RTPrikaži ovu nitHvala. Twitter će to iskoristiti za poboljšanje vaše vremenske crte. PoništiPoništi -
Davide Castaldi proslijedio/la je Tweet
https://www.unimi.it/it/ricerca/ricerca-lastatale/fare-ricerca-da-noi/assegni-e-borse/bandi-assegni-di-ricerca/bando-di-tipo-b-prof-testa-id-4474 … https://www.unimi.it/it/ricerca/ricerca-lastatale/fare-ricerca-da-noi/assegni-e-borse/bandi-assegni-di-ricerca/bando-di-tipo-b-prof-testa-id-4473 … Two open positions at our lab. Work with
#brainorganoidsHvala. Twitter će to iskoristiti za poboljšanje vaše vremenske crte. PoništiPoništi -
Davide Castaldi proslijedio/la je Tweet
Very grateful with
@gtesta72, for the chance to enjoy groundbreaking science at#cshlbrain,#Organoids, here seen sharing his vision on@humantechnopole.@Crockol@SebastianoTrat@CarloEmanueleV1@castaldi_davide@polvere7pic.twitter.com/QaLsRUqaBJ
Hvala. Twitter će to iskoristiti za poboljšanje vaše vremenske crte. PoništiPoništi -
Davide Castaldi proslijedio/la je Tweet
Ultra-high throughput scRNA-seq from Christoph Bock's lab! Combines combinatorial barcoding with droplet microfluidics to sequence >150,000 cells on a single
@10xGenomics lane:https://www.biorxiv.org/content/10.1101/2019.12.17.879304v1 …Hvala. Twitter će to iskoristiti za poboljšanje vaše vremenske crte. PoništiPoništi -
Davide Castaldi proslijedio/la je Tweet
New lab paper up. Vireo allows for multiplexed single cell analysis using natural genetic variants for demultiplexing. The model can use existing genotype references or cluster samples de novo. With
@YuanhuaHuang and @davisjmcc.https://genomebiology.biomedcentral.com/articles/10.1186/s13059-019-1865-2 …Hvala. Twitter će to iskoristiti za poboljšanje vaše vremenske crte. PoništiPoništi -
Davide Castaldi proslijedio/la je Tweet
featuring amazing work by
@Alecentauro1@SebastianoTrat@Crockol@CarloEmanueleV1@castaldi_davide@MarijaM_75 and other members of#Testalab.euPrikaži ovu nitHvala. Twitter će to iskoristiti za poboljšanje vaše vremenske crte. PoništiPoništi -
Davide Castaldi proslijedio/la je Tweet
A new study suggests modern humans domesticated themselves after they split from their extinct relatives, Neanderthals and Denisovans, approximately 600,000 years ago.https://fcld.ly/wfvvhgz
Hvala. Twitter će to iskoristiti za poboljšanje vaše vremenske crte. PoništiPoništi -
Davide Castaldi proslijedio/la je Tweet
Thymic epithelial progenitors from human iPSCs. Thanks to
@gtesta72 for letting me work on this intriguing subject.@SebastianoTrat@CarloEmanueleV1@castaldi_davide@GianlucaVozza1pic.twitter.com/RZgMIbAoBS
Hvala. Twitter će to iskoristiti za poboljšanje vaše vremenske crte. PoništiPoništi -
Davide Castaldi proslijedio/la je Tweet
delighted to share our latest work
#brain#organoids#singlecell Human Cortical Organoids Expose a Differential Function of GSK3 on Cortical Neurogenesishttps://www.cell.com/stem-cell-reports/fulltext/S2213-6711(19)30334-0#.Xa3cddVtKmc.twitter …Prikaži ovu nitHvala. Twitter će to iskoristiti za poboljšanje vaše vremenske crte. PoništiPoništi -
Very proud and super excited to enroll in the Systems Medicine - Computational Biology PhD program at SEMM, as the first-generation of
#humantechnopole students in@gtesta72's Lab!Hvala. Twitter će to iskoristiti za poboljšanje vaše vremenske crte. PoništiPoništi -
Davide Castaldi proslijedio/la je Tweet
Diamo il benvenuto ai sette scienziati del team
#HumanTechnopole! Portano in Italia
la loro esperienza per sviluppare i nostri primi centri di ricerca: genomica, neuro-genomica, biologia computazionale & strutturale. Maggiori info sul nostro sito: https://bit.ly/2nLXOCb pic.twitter.com/ocUZadb6px
Hvala. Twitter će to iskoristiti za poboljšanje vaše vremenske crte. PoništiPoništi -
Davide Castaldi proslijedio/la je Tweet
Single cell warm up for http://testalab.eu , together with
@CarloEmanueleV1 at#SCG2019, special thanks to@gtesta72 and all the lab. Exciting and thriving event by@slinnarsson@IdoAmitLab@MarioniLab and other great participants http://weizmann.ac.il/conferences/SCG2019 …pic.twitter.com/S7vOhzmDp1
Hvala. Twitter će to iskoristiti za poboljšanje vaše vremenske crte. PoništiPoništi -
Davide Castaldi proslijedio/la je Tweet
scRNAseq folks: please try our new method. it assigns a genotype to each cell using variants from the reads while also estimating and accounting for ambient RNA from the "soup". it does better than anything else out there right now. congrats
@Haynes_Heaton on great work.https://twitter.com/biorxivpreprint/status/1150374705972621313 …Hvala. Twitter će to iskoristiti za poboljšanje vaše vremenske crte. PoništiPoništi -
Davide Castaldi proslijedio/la je Tweet
so thrilled to be part of such exciting developments; stay tuned fo our awesome
@CarloEmanueleV1 spearheading analytical single-cell omic strategies for organoids and representing the http://Testalab.eu at the@LifeTimeFET unconference@LaStatale@IEOufficialehttps://twitter.com/LifeTimeFET/status/1153232042806718464 …
Hvala. Twitter će to iskoristiti za poboljšanje vaše vremenske crte. PoništiPoništi -
Davide Castaldi proslijedio/la je Tweet
#Snakemake 5.4.5 is released, with improved error messages and a minor bug fix: https://snakemake.readthedocs.io#sciworkflows#reproducibilityHvala. Twitter će to iskoristiti za poboljšanje vaše vremenske crte. PoništiPoništi -
Davide Castaldi proslijedio/la je Tweet
#singlecellgenomicsday all TestaLab's http://www.testalab.eu bioinformatic room is online!!@gtesta72@castaldi_davide#TshirtsToMilan
Hvala. Twitter će to iskoristiti za poboljšanje vaše vremenske crte. PoništiPoništi -
Davide Castaldi proslijedio/la je Tweet
Takeaways from amazing
#KSsinglecell: 1. Spatial technologies are mature, and are tremendously exciting 2. Integrating scRNA-seq data with cell morphology, location, and functional readouts is key for interpretation 3. Single cell genomics is transforming developmental biologyHvala. Twitter će to iskoristiti za poboljšanje vaše vremenske crte. PoništiPoništi -
Davide Castaldi proslijedio/la je Tweet
ATGGAGAGGAGGTACTGCCACAGGATCAGCACCATGGCCAGCGCCAACGACGCCCACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG from everyone at Ensembl! http://buff.ly/1Izo5qL
Hvala. Twitter će to iskoristiti za poboljšanje vaše vremenske crte. PoništiPoništi
Čini se da učitavanje traje već neko vrijeme.
Twitter je možda preopterećen ili ima kratkotrajnih poteškoća u radu. Pokušajte ponovno ili potražite dodatne informacije u odjeljku Status Twittera.